Review




Structured Review

Synthego Inc multi grna mix
Multi Grna Mix, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi-grna/grna+mix+multi/10__1158_slash_1078___0432__ccr___24___1977-94-15-17
Average 86 stars, based on 1 article reviews
multi grna mix - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Recombinant:

Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity
Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2 μL of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1 μL of 20 μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12 μL Primary Cell P3 Nucleofector solution (Lonza, V4XP-3032) and incubating at RT for 20 min. To 2.5x10 5 cells in 5 μL Nucelofector solution, 0.8 μL of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15 μL of the RNP solution and mixed by pipetting.

Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity.
Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2 mL of 100 mM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1 mL of 20 mM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12 mL Primary Cell P3 Nucleofector solution (Lonza, V4XP-3032) and incubating at RT for 20 min. To 2.5x105 cells in 5 mL Nucelofector solution, 0.8 mL of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15 mL of the RNP solution and mixed by pipetting.

Article Title: SOX2 drives fetal reprogramming and reversible dormancy in colorectal cancer
Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2μl of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1μl of 20μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12μl Primary Cell P3 Nucleofector solution (Lonza, V4XP- 3032) and incubating at RT for 20 min. To 2.5×10 5 cells in 5μl Nucleofector solution, 0.8μl of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15μl of the RNP solution and mixed by pipetting.

Electroporation:

Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity
Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2 μL of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1 μL of 20 μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12 μL Primary Cell P3 Nucleofector solution (Lonza, V4XP-3032) and incubating at RT for 20 min. To 2.5x10 5 cells in 5 μL Nucelofector solution, 0.8 μL of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15 μL of the RNP solution and mixed by pipetting.

Article Title: Single-cell analysis defines a pancreatic fibroblast lineage that supports anti-tumor immunity.
Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2 mL of 100 mM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1 mL of 20 mM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12 mL Primary Cell P3 Nucleofector solution (Lonza, V4XP-3032) and incubating at RT for 20 min. To 2.5x105 cells in 5 mL Nucelofector solution, 0.8 mL of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15 mL of the RNP solution and mixed by pipetting.

Article Title: SOX2 drives fetal reprogramming and reversible dormancy in colorectal cancer
Article Snippet: Ribonucleoprotein (RNP) complexes were formed by diluting 2μl of 100 μM of multi-gRNA (Synthego) in Tris-EDTA (TE) (Synthego) and 1μl of 20μM recombinant Cas-9 (Integrated DNA Technologies (IDT), 1081059) in RNase-free PBS in 12μl Primary Cell P3 Nucleofector solution (Lonza, V4XP- 3032) and incubating at RT for 20 min. To 2.5×10 5 cells in 5μl Nucleofector solution, 0.8μl of Electroporation Enhancer Solution (IDT, Alt-R Cas9 Electroporation Enhancer, 2 nmol) was added, followed by 15μl of the RNP solution and mixed by pipetting.



Similar Products

86
Synthego Inc multi grna mix
Multi Grna Mix, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi-grna/grna+mix+multi/10__1158_slash_1078___0432__ccr___24___1977-94-15-17
Average 86 stars, based on 1 article reviews
multi grna mix - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Synthego Inc multi-grna
Multi Grna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi-grna/multi+grna/bio_rxiv__2024__09__11__612412-360-12-13
Average 90 stars, based on 1 article reviews
multi-grna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc multi targeting grnas plasmid phage to dcas9 3xgfp expressing dcas9 3xgfp
Multi Targeting Grnas Plasmid Phage To Dcas9 3xgfp Expressing Dcas9 3xgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi-grna/pHAGE-TO-dCas9-3XGFP+(Plasmid+%2364107)/pm37953351-235-3-19
Average 93 stars, based on 1 article reviews
multi targeting grnas plasmid phage to dcas9 3xgfp expressing dcas9 3xgfp - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Synthego Inc fbxw7 multi-grna sequences
Western blot validation (A) Western blot of <t>FBXW7</t> protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).
Fbxw7 Multi Grna Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi-grna/fbxw7+multi+grna+sequences/pmc09826973-42-0-7
Average 90 stars, based on 1 article reviews
fbxw7 multi-grna sequences - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Synthego Inc multi-grna mix synthego
Western blot validation (A) Western blot of <t>FBXW7</t> protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).
Multi Grna Mix Synthego, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi-grna/multi+grna+mix+synthego/pmc08683436-357-15-17
Average 90 stars, based on 1 article reviews
multi-grna mix synthego - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Synthego Inc multi-grna approach
Western blot validation (A) Western blot of <t>FBXW7</t> protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).
Multi Grna Approach, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi-grna/multi+grna+approach/pmc08683436-354-9-11
Average 90 stars, based on 1 article reviews
multi-grna approach - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Western blot validation (A) Western blot of FBXW7 protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).

Journal: STAR Protocols

Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

doi: 10.1016/j.xpro.2022.101978

Figure Lengend Snippet: Western blot validation (A) Western blot of FBXW7 protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).

Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

Techniques: Western Blot, Biomarker Discovery, Knock-Out, Expressing

Immunofluorescent validation Immunofluorescent validation of FBXW7 wild-type and knockout with DAPI (blue), F-actin (red) and FBXW7 (green). Scale bar equals 50 μm.

Journal: STAR Protocols

Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

doi: 10.1016/j.xpro.2022.101978

Figure Lengend Snippet: Immunofluorescent validation Immunofluorescent validation of FBXW7 wild-type and knockout with DAPI (blue), F-actin (red) and FBXW7 (green). Scale bar equals 50 μm.

Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

Techniques: Biomarker Discovery, Knock-Out

Journal: STAR Protocols

Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

doi: 10.1016/j.xpro.2022.101978

Figure Lengend Snippet:

Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

Techniques: Recombinant, Software, Cell Culture, Transferring, Membrane, Microscopy, Transfection